PSO-RE

Protein Sequence Optimizer – Restriction sites removal

PSO-RE is a API endpoint to remove unwanted restriction enzymes from a DNA sequence while keeping the original CDS.
Once added the input parameters and run the API, the request will be added to our tasks queue, and the system will return a task id to use in the successive phases of the process. By means of the task id previously generated, you can access the status of the computation while running and the outcomes once completed.

Parameters

input_sequence : The sequence to be optimized, either a DNA or an amino acid sequence.

upstream_sequence : Any upstream sequence to the target, this parameter is valid only if the target sequence is DNA. We use this parameter to check for junction restriction enzymes and avoid unfavourable structures at the beginning of the sequence.

downstream_sequence : Any downstream sequence to the target, this parameter is valid only if the target sequence is DNA. We use this parameter to check for junction restriction enzymes

restriction_sites_to_avoid : A list of restriction enzymes to avoid. Please list the name of the enzymes to forbid. This parameter supports the commercially available enzymes from the REBASE database (listed in the commdata file).

forbidden_strings : A list of custom DNA sequences to avoid. You can use this parameter also to add custom restriction sites. Please list the DNA sequence

Example

Input payload

{
    "input_sequence": "AAAGAATTCGACTATCCGGAT",
    "upstream_sequence": "ATGAACACTTTC",
    "downstream_sequence": "ATGAACACTTTC",
    "restriction_sites_to_avoid": [
        "Kpn2I",
        "EcoRI"
    ],
    "custom_forbidden_strings": [
        "ATTATTAT"
    ]
}

POST response

{
  "id": "3fa85f64-5717-4562-b3fc-2c963f66afa6"
}

Output

GET endpoint

 https://api-testing.officinae.bio/api/v1/tasks/{task_id}
 e.g. https://api-testing.officinae.bio/api/v1/tasks/3fa85f64-5717-4562-b3fc-2c963f66afa6

Output

{
  "filtered_string": "AAAGAATTTGACTACCCAGAC",
  "remaining_strings": 0
}