Skip to content

SF-DOCTOR

Synthesis Fragment Doctor

SF-DOCTOR (Synthesis Fragment Doctor) is a API endpoint to check your synthesis fragment manufacturability. Would you like to try it?

>> Get in touch <<

Parameters

fragment_sequence : the DNA sequence to be synthesized.

manufacturing_rules: the set of rules you want to to check your sequence against. Currently supported manufacturing rules: Default, CODEX DNA fragments, CODEX DNA libraries, DOULIX std


Example

Input payload

{
    "fragment_sequence": "ATGAACACTTTCTTCTCCTCAGACCAGGTCTCGGCGCCCGATCGCGTCGCGCTCTGGCACGATGTCATCTGCCGTAGCTATGTCCCGCTCAAC",
    "manufacturing_rules": "Doulix"
}