SF-DOCTOR
Synthesis Fragment Doctor¶
SF-DOCTOR (Synthesis Fragment Doctor) is a API endpoint to check your synthesis fragment manufacturability.
Would you like to try it?
>> Get in touch <<
Parameters¶
fragment_sequence : the DNA sequence to be synthesized.
manufacturing_rules: the set of rules you want to to check your sequence against. Currently supported manufacturing rules: Default, CODEX DNA fragments, CODEX DNA libraries, DOULIX std
Example¶
Input payload¶
{
"fragment_sequence": "ATGAACACTTTCTTCTCCTCAGACCAGGTCTCGGCGCCCGATCGCGTCGCGCTCTGGCACGATGTCATCTGCCGTAGCTATGTCCCGCTCAAC",
"manufacturing_rules": "Doulix"
}